Variant Discovery, Annotation & Filtering With Samtools & the GATK

While the UnifiedGenotyper included within the Genome Analysis Toolkit (GATK) provides an ample method by which to call SNPs and indels, mpileup within Samtools still remains a reliable, quick and straightforward way to get variants.

Raw VCF file from Samtools

Raw VCF file from Samtools, notice lack of annotations & filters in the 3rd and 7th columns

To begin we take our assembled bam files created by the method of your choice, two of which are described in the previous posts[1][2].  With newer versions of Samtools the pileup function is replaced by mpileup, they perform the exact same actions; however, in traditional pileup we pass a single individual genome as a bam file for variant discovery, while in mipleup we can pass multiple individuals together and each of their variants are discovered within a single file as the output.

$samtools mpileup -uf [reference.fa] [.bam 1] [.bam 2] [.bam...] | bcftools view -bvcg -> [raw.variant.bcf]
$bcftools view [raw.variant.bcf] > [raw.variant.vcf]

Even though we’re saying the variant discovery is by samtools, all the actual work is being done by bcftools. To learn more about what bcftools can do check out the documentation, all the modules are included as a subdirectory within the samtools package.

Now that we have a VCF file containing all the positions where our samples differ from the reference, and each other, we can begin to utilize the appropriate GATK modules. Starting with annotation:

$java -Xmx[allocate memory] -jar GenomeAnalysisTK.jar -T VariantAnnotator -R [reference.fa] --variant [raw.vcf] --dbsnp [db.vcf] -L [raw.vcf] --alwaysAppendDbsnpId -o [annotated.vcf]

As you can see these one liners can get quite long, but rest assured, the results are worthwhile. If you look carefully at the above command you can see that we’re annotating based on a second VCF file, which in this case is being attained from the NCBI’s dbSNP. Feel free to use whatever database you see fit to generate your annotations.

Annotated VCF, notice rsIDs in 3rd column

Annotated VCF, notice rsIDs in 3rd column

Annotating our raw VCF with a dbSNP file results in flagging any polymorphisms between our sets to be marked with an rsID. These unique identifiers are used to track individual disease phenotypes, which are at various points of experimental validation. However, if we take our mapped genome and search for variations we’ll soon find that there are simply too many variations that show up to make any sense of our data. We have to decrease the size of our haystack before we start looking for our needle. This is where Filtration comes in. A high-level overview of the process can be seen in this previous post which utilizes a key figure from Genomics & Computation (available on iTunes). Below we execute a part of these concepts using GATK:

$java -Xmx[allocate memory] -jar GenomeAnalysisTK.jar -T VariantFiltration -R [reference.fa] --input [input.vcf] -o [output.vcf] --filterExpression "[insert expression]" --filterName "[expression name]"

It is important to understand the one-to-one mapping of filtering expression to the filter name to adequately use this module. A filterExpression should take any number of fields available within the INFO field for any given variation, such as:

AC1=1;AF1=0.5005;DP=130;DP4=3,0,4,3;FQ=3.02;MQ=44;PV4=0.47,0.038,1,0.19;VDB=0.0253

For example the expression could take into account the depth of read as well as the mapping quality, stating 25>DP>10 & 45>MQ>50. However these expressions have to be written in Java Expression Language (JEXL) and are then mapped directly to the following filterName, multiple expression/name combinations can be linked in a single pipe.

Trio Variant Visualization w/ HivePlot

Trio Variant Visualization w/ HivePlot

There are many more steps towards refinement, i.e. recalibration and variant selection, but this blog post is getting quite long. And I think if you follow the roadsigns laid out here the full abilities of both Samtools & the GATK will become evident. The final payoff being reliable, meaningful, and thus useful, NGS data. Hit me up if you get stuck or think my ways are lame.

8 Comments

Filed under Genomics

Exome Sequence Assembly Utilizing Bowtie & Samtools

OG BrowserAt the end of all the wet chemistry for a genome sequencing project we are left with the raw data in the form of fastq files. The following post documents the processing of said raw files to assembled genomes using Bowtie & Samtools.

Raw data is split into approximately 20-30 fastq files per individual

Each of these raw files, once uncompressed, contains somewhere around 1 gigabyte of nucleotide, machine, and quality information. Which will follow the fastq guidelines and look very similar to the following. It’s quickly noticeable where our nucleotide data consisting of ATGC lives within these raw files.

@HWI-ST1027:182:D1H4LACXX:5:2306:21024:142455 1:N:0:ACATTG
GATTTGAATGGCACTGAATATACAGATCAACTTGAAGATAACTGATATCTAAACTATGCTGAGTCTTCTAATTCATGAACACAGTACATTTCTATTTAGG
+
@?<DFEDEHHFHDHEEGGECHHIIIIIGIGIIFGIBGHGBHGIE9>GIIIIIIIIIIIFGEII@DCHIIIIIIGHHIIFEGHBHECHEHFEDFDFDCEE>
@HWI-ST1027:182:D1H4LACXX:5:2306:21190:142462 1:N:0:ACATTG
GCCCTTTTCTCTCCCAGGTGGGAGGCAGATAGCCTTGGGCAAATTTTCAAGCCCATCTCGCACTCTGCCTGGAAACAGACTCAGGGCTATTGTGGCGGGG
+
CCCFFFFFHHHHHJJJJJEGIJHIJJJIJHIJJJJJJJJJJIJJJJIJJJJIJJJJJJIIJHHHFFFFFFEDEEECCDDDDDDDDDDDDDDDEDDBDDB#

At this point the raw reads need to be assembled into contiguous overlapping sets, then chromosomes, and finally the entire genome. There are two general approaches here, template-based and de novo assembly. For this particular exome data set it is prudent to move forward with template-based assembly using the latest build of the human reference genome. An index of the reference genome must be built for bowtie, some indexes are also available for download though the file size can be quite large.

$ bowtie-build /Users/mokas/Desktop/codebase/max/hg19.fa hg19
Settings:
 Line rate: 6 (line is 64 bytes)
 Lines per side: 1 (side is 64 bytes)
 Offset rate: 5 (one in 32)
 FTable chars: 10
...
Getting block 6 of 6
 Reserving size (543245712) for bucket
 Calculating Z arrays
 Calculating Z arrays time: 00:00:00
 Entering block accumulator loop:
 10%
 20%
...
numSidePairs: 6467211
 numSides: 12934422
 numLines: 12934422
Total time for backward call to driver() for mirror index: 02:00:28

The entire reference build should be complete within an hour or two, which may be faster than downloading an pre-built index. At this point the raw fastq file is ready to be processed using our indexed template.

$ bowtie -S [ref] [fastq] [output.sam]

At the end of this step we will have a .sam (Sequence Alignment Map) file, which will have each of our raw reads aligned to certain positions on the human reference. However, the reads will be in no useful order, and all the chromosomes and locations are mixed together.
To be able to move through such a large file with speed and ease it must be converted into a binary format, at which point all the reads can be sorted into a meaningful manner.

$ samtools view -bS -o [output.bam] [input.sam]
$ samtools sort [input.bam] [output.sorted]

We are now left with a useful file where our raw reads are assembled and sorted based on a template.

This file can be visualized and analyzed in a wide variety of available programs, the format is also accessible enough to quickly build your own tools around it. Once each of the 20-30 fastq files in a single sample have been processed in this manner the files can be merged, converted into binary for reduced file size, and indexed for quick browsing. IGV is one of the more useful browsers as a result of its simplicity and ability to quickly jump around all along the genome. Getting a cursory looks at how an assembly went.

Integrative Genomics Viewer

This post is the part of a set providing initial documentation of a systematic comparison of various pipelines with a wide range of algorithms and strategies. Check out the next post in the series on assembly with BWA & Picard.

2 Comments

Filed under Genomics

Virtualization of Raw Experimental Data

Earlier today it was announced that the 2012 Nobel Prize in Physiology/Medicine would be shared by Shinya Yamanaka for his discovery of 4 genes that could turn a normal cell back into a pluripotent cell. 

An effect originally shown by John B. Gurdon with his work on frog eggs over 40 years ago. The NCBI’s Gene Expression Omnibus (GEO) database under accession number GSE5259 contains all 24 candidate genes that were suspected to play a role in returning a cell to a non-specialized state. A practical near-term impact of the research however may be overlooked. That is you can have all of Dr. Yamanaka’s experimental DNA microarray data used in making the prize winning discovery.

Unless you’ve been living under a rock on Mars, or you don’t care what dorky scientists are up to, then you may have heard of the ENCODE project. The Encyclopedia of DNA Elements isn’t winning any Nobel Prizes, not yet anyways, and if what many researchers believe to be true, it never will. All the datasets can be found, spun up, played with, and used as fodder for a new round of pure in silico research from the ENCODE Virtual Machine and Cloud Resource.

What ENCODE and the Nobel Prize in Medicine have in common is ushering in a new paradigm of raw experimental data/protocol/methodology sharing.  ENCODE, which generated huge amounts of varied data across 400+ labs has made all of the raw data available online. They go one step further to provide the exact analytic pipelines utilized per experiment, including the raw datasets, as Virtual Machines. The lines between scientist and engineers are blurring, the best of either will have to be a bit of both. From the Nobel data, can you find the 4 genes out of the 24 responsible for pluripotent mechanisms? Are there similarly valuable needles, lost in the haystack of ENCODE data? Go ahead, give it a GREP through.

Citations:

Leave a comment

Filed under Genomics, Microbiology

Anomaly Detection In The Human Genome

Discovering genomic variations within a single individual, which is also the underlying factor in a previously undiagnosed pathology, can be thought of as a anomaly detection problem. Colloquially referred to as the needle in a haystack.

Multi-pass Exome filtering is illustrated


The NCBI’s human reference genomes allows for the largest filter, enabling identification of initial variants. Next, alternate loci patches to the primary build of the human reference genome, accounting for large regions of variability, will reduce the number of variants, which will still remain too large for efficient annotation. An additional resource taps into SNP databases. The NCBI’s dbSNP provides a large set of SNP locations, meanwhile The National Cancer Institute also contains a large curated database of SNPs which are placed within three categories: Confirmed, Validated, and Candidate SNPs.

Shown in the figure above are three exomes which, after comparison with the primary human reference build contain large variant sets. These are then passed on to alternate loci, and finally SNP filters. The end result being discovery of novel variants, which may be responsible for idiopathic indications.

1 Comment

Filed under Genomics

Common Visualization Methods in Genomics

Because the genome contains such a wealth of information, and in a language which we don’t quite understand, it is of utmost importance to organize it in meaningful ways. As there is no precedent for this syntax, recognizing and documenting adequate patterns is key. Currently there are approximately five conventional methods of visualizing genomic data.

a) Tracks: The bane of academics and government researchers everywhere, sequences represented as rows. Track browsers can display multiple dimensions of the same set of data as well as comparative sets. UCSC Genome Browser is the standard example for this method. However, their usefulness is often limited to close-level, specific targets.

Whole genome exploration and comparison within these browsers tends to be tedious and unfruitful.

b) Heat Maps:  These are likely what the layperson imagines when they think of genomic visualization. Normally encompassing a rectangle containing multi-colored blocks in rows and columns. This method is particularly prevalent amongst microarray data. IGV, the Integrative Genome Viewer can generate heat maps quite well, so can some all-purpose tools such as R Statistics and Gnuplot.

Heat maps have the advantage of providing a larger scale correlative representation of two dimensional data. While still holding on to some of the qualities of track browsing.

c) Circular Genome Maps: A method that attempts to combine the robustness of the track maps in a less overwhelming take. Here strips of data are aligned in concentric circles, making it easier to see possible correlations. Circular maps have shown to be especially helpful recently in showcasing drug/gene interactions. Genome Projector by Arakawa et al. can generate great circular genome maps, amongst other methods.

Circular genome maps have become quite popular of late, as they allow whole genome visualization in a single snapshot. Moreover, multiple dimensions can be represented, as concentric circles.

d) DNA Walks: Are a relatively new method which represent genomic data vectors in a two dimensional plane. Where each letter (A,T,G,C) denotes a direction (up, down, left, right). This method has been helpful in generating a single unique image representative of the sequence in question, and is particularly adapt at showcasing small changes in structural contents, i.e. GC rich regions or poly A tails.

In a DNA walk each base is assigned a direction, i.e. A up, T, down, G left, C right.

e) Network Maps: Originally used to help understand computer networks, this method has quickly proven valuable to systems biology. In viewing the genome, pathways of interactions that were once obscure are allowed to move to the foreground, as well as seeing inherent divisions in function within the genome. The go-to software at the moment is Cytoscape, although Ayasdi is showing to be a wonderful competitor.

One draw back to network mapping genomes, is the likely requirement of annotation. That is, functions must be somewhat defined, raw genomic data is unlikely to be mapped in a meaningful manner with network maps in their current state.

Life science researchers, clinicians, and software engineers all stand to benefit from and are required, for humanity to get a useful grasp on this powerful language. These visualization techniques are, as mentioned, tried and tested. We must learn from, evolve, and iterate them into new tools which strike a balance on imposing our own will on the data and showcasing its inherent, underlying structures.

See:

Previous post “Chaos Game Analysis of Genomes” & work by GeneDrop.

Leave a comment

Filed under Genomics

What Are You Waiting For- A Certain Shade of Green? Core Science & Tech Development

Solving difficult scientific or engineering problems has proven itself to be the greatest benefactor of long-term growth and development. However, finding support for fundamental technological developments has come increasingly under fire in recent years.

From “Amusing Ourselves to Death” By Neil Postman, a book about the possibility that Aldous Huxley, not Orwell, was right.

It is not just crying wolf, and we have all heard this message before, funding for science is low, the space program takes cuts, fewer technical majors, Justin Bieber is more popular than The Doors.

A fantastic metric to determine whether our resources, in sum, are being allocated fruitfully is to look at pooled returns of venture fund indexes. Starting with its birth in the 1960s, to the 1990s. Venture capital had excellent returns, and it often closely associated with the high-capital, slow-growth, semiconductor and biotechnology industries.

VC funds have posted negative mean and median returns, starting in 1999 through the present. A small fraction of firms are the exception.

In the new millennium however, we have encountered a new paradigm for returns amongst these indexes, a shift from funding transformational technologies to supporting companies solving incremental, or “hype” based problems. A shift from long-term garden like growth, to one equivalent to big game hunting. Steve Blank, who is invested in Ayasdi, said it best recently, stating:

If investors have a choice of investing in a blockbuster cancer drug that will pay them nothing for fifteen years or a social media application that can go big in a few years, which do you think they’re going to pick? If you’re a VC firm, you’re phasing out your life science division.

This perspective is beyond the bubble argument, or the oscillations of markets. It marks the creeping penetration of triviality into our investment culture. Furthermore, it is not a decision by any individual, rather the whole return of investment ecosystem has created an illusion highlighting consumer, social, and entertainment products.

Illumina HiSeq systems, a core technology driving contemporary life-science discoveries.

Venture is often associated with bravely expanding our horizons, to seek out new lands, and bring back riches that will ensure growth for generations to come. Where will we go after all the shoe stores, and match-makers have migrated online? Once the saturation of social media has reached nauseating ubiquity? To truly create long-term returns, that assure the future financial stability of the investor, scientist/engineer, and society we must lead, not follow the bandwagon, or be part of the “me too” culture.

Citations:

“Cambridge Associates LLC U.S. Venture Capital Index® And Selected Benchmark Statistics” 2011

“Lessons from Twenty Years of the Kauffman Foundation’s Investments in Venture Capital Funds and The Triumph of Hope over Experience” 2012

“What Happened To The Future” – FoundersFund Manifesto

2 Comments

Filed under BigPharma, Genomics

K-Mistry Typeface By Ranmalee Jayaratne

I wanted to take a moment to thank Ranmalee for her wonderful concept and execution of the K-mistry type face in the banner for this site. 

It is refreshing to see young designers take on the difficult challenge of presenting the life sciences and other technical  sectors as appealing. Although it does not come as a surprise that Ranmalee, a 21 year old from Sri Lanka who decided to switch her studies from advanced mathematics to design, found such a wonderful way to balance her output.

If you’re like me, and look forward to what Ms. Jayaratne will create next, be sure to keep an eye on her Behance page.

Leave a comment

Filed under Uncategorized

Closing The Gap Between Computational & Pharmaceutical Innovation

When confronted with the mortality of life, it becomes painfully clear that medicine has not been able to keep up with information and computational innovations. At the heart of the problem stands  the drug development process, where an average of 5 to 10 years of research and billions of dollars worth of investment often fails to produce a product.

Drug Probability of Success to Market

Figure 1 | Probability of success to market from key milestones. Data: cohort of 14 companies.

In the past few years, molecules in development have seen a frightening rate of attrition. The most capital and resource intensive period comes during the clinical trials, which can be broken-down into the following stages: Phase I trials evaluate if a new drug is safe, Phase II and Phase III trials assess a drug’s efficacy, monitor side effects, and compare the drug to similar compounds already on market. Recent studies by the Centre for Medicines Research, places Phase II success rates at 18%, lower than at any other time during drug development [1]. Spending on average of $300 million to $1 Billion up until this point of research is par for the course [2].

Successful Discovery Strategies

Figure 2 | Computer-assisted screenings and traditional discovery strategy distributions of new molecular entities (NME). Followers are in the same class as previously approved drugs.

By contrast, computational drug design strategies have made tremendous advances in the new millennia with new tools to identify targets and virtual screening assays. These include structure-based tools to lead identification and optimization utilizing X-ray crystallography. As well as, high-throughput target-based screenings of key protein families like G protein-coupled receptors. Promising indicators of computational drug designs are encouraging new companies to court Big Pharma, who to-date have relied on academia or internal projects for computation. For a company like GeneDrop, even a fraction of the development budget would be adequate to deliver favorable results.

Drug development’s addressable market-size for global corporations such as Novartis or Roche, which have between 20-100 molecules in the pipeline at a given time, is estimated at  $1.11 Trillion in 2011; down from $1.24 Trillion in 2001 [2]. There are approximately ten large pharmaceutical companies and many small ones with one or two late-stage molecules in development.

Early-Stage Computational Drug Design

Fig 3 | Early-stage computational drug design flow

To-date, most computation in the space has been limited to early-stage research on the discovery of molecules prior to the clinical trial phases. However, the fall in market cap has sent drug companies scrambling as patents on existing blockbuster drugs near expiration, and those in development see increasingly high failure rates. This begs the question: why are computational resources being spent in the early-stage, when most failures occur in the late-stage, during Phase II?

Pharmacogenomics

Fig 4 | Pharmacogenomics attempts to correlate how individuals will respond to drugs based genomic variability.

As always, cost has been a primary factor. Late-stage computation has meant analysis of bio-metric data, which has been limited to blood-work and questionnaires of trial subjects. The pie in the sky of course, has always been genomics, the price of which was deemed too high. Even up to a couple of years ago, it would cost over $10,000 to sequence an individual. With Phase II and III trials consisting of hundreds to thousands of patients, the method was rarely used. As of the last few months this is no longer the case, with the cost hovering around $5,000 and quickly approaching $1000 per patient.

So, we are faced with an enticing opportunity for information technology to rescue a high-capital, old-world industry. Threading this needle however is no easy task; entrenched industries with high quarterly revenues are notoriously conservative when adopting innovation, especially from the outside. Adding to this is the high barrier of the technical languages of the hard-sciences and the networking culture of global corporations. Luckily both are boundaries which have been broken before in other industries and we can be optimistic; if anyone can break it, it is the passionate and talented.

Citations:

[1] Trial watch: Phase II failures: 2008–2010 by J. Arrowsmith – Nature Reviews Drug Discovery 10, 328-329 (May 2011) | doi:10.1038/nrd3439

[2] – Fig 1- A decade of change by J. Arrowsmith – Nature Reviews Drug Discovery 11, 17-18 (January 2012) | doi:10.1038/nrd3630 

[3] – Fig 2- How were new medicines discovered? by David C. Swinney & Jason Anthony – Nature Reviews Drug Discovery 10, 507-519 (July 2011) | doi:10.1038/nrd3480

[4] – Fig 4 – Genomics in drug discovery and development by Dimitri Semizarov, Eric Blomme (2008) ISBN 0470096047, 9780470096048

Leave a comment

Filed under BigPharma, Genomics

Chaos Game Analysis of Genomes

Triforce Power

Genomic code that makes us is made up of four letters, ATGC. Billions of these letters together creates a lifeform. Iterated function systems (IFS) are anything that can be made by repeating the same simple rules over and over. The easiest example being tree branches, add a simple structure repeatedly ad-infinitum and before you know it we have complex and beautiful systems; the popular example being the Sierpinski Triangle or “triforce” for the Zelda fans. As the cost of DNA sequencing becomes cheaper day by day we are confronted with a tsunami of data and it has become exceedingly difficult to derive meaningful answers from all the information contained within us.

H. Sapiens

Finding any advantage in ways to organize and view the data helps us discover minuet differences between individuals or say a normal cell versus a cancer cell. This is where Chaos Game Representation (CGR) becomes helpful, CGR is just a form of IFS that is helpful in mapping seemingly random information, that we suspect or know to have some sort of underlying structure.

In our case this would be the human genome. Although when looking at the letters coming from our DNA it seems like billions of random babbles, it is of course organized in a manner to give the blueprint for our bodies.  So let’s roll the dice-  do we get any sort of meaningful structure when applying CGR to DNA? If you are so inclined, something fun to try is the following:

genome = Import["c:\data\sequence.fasta", "Sequence"];
genome = StringReplace[ToString[genome], {"{" -> "", "}" -> ""}];
chars = StringCases[genome, "G" | "C" | "T" | "A"];
f[x_, "A"] := x/2;
f[x_, "T"] := x/2 + {1/2, 0};
f[x_, "G"] := x/2 + {1/2, 1/2};
f[x_, "C"] := x/2 + {0, 1/2};
pts = FoldList[f, {0.5, 0.5}, chars];
Graphics[{PointSize[Tiny], Point[pts]}]

g1346a094 on Chromosome 7

For example, reading the sequence in order, apply T1 whenever C is encountered, apply T2 whenever A is encountered, apply T3 whenever T is encountered, and apply T4 whenever G is encountered. Really though any transformations to C, A, T, and G can be used and multiple methods can be compared. Self-similarity is immediately noticeable in these maps, which isn’t all that surprising since fractals are abundant in nature and DNA after all, is a natural syntax. Being aware that these patterns exist within our data, opens us up to some new questions to evaluate if IFS, CGR and fractals in general are helpful tools in the interpretation of genomic data.

Signal transducer 5B (STAT5B), on chromosome 17

Since the mapping is 1-1 and we see patterns emerge, we are hinted that there may be biological relevance; especially because different genes yield different patterns. But what exactly are the correlations between the patterns and the biological functions? It would also be very interesting to see mappings of introns/exons colored differently or color amino acids and various codons. One thing is for sure, genomes aren’t just endless columns and rows of letters, they are pictures. It is much easier to compare pictures and discover variations, which can ultimately allow us to find meaningful interpretation from this invaluable data.

Citations:

Jeffrey, H. J., “Chaos game visualization of sequences,” Computers & Graphics 16 (1992), 25-33.

Ashlock, D. Golden, J.B., III. Iterated function system fractals for the detection and display of DNA reading frame (2000) ISBN: 0-7803-6375-2

VV Nair, K Vijayan, DP Gopinath ANN based Genome Classifier using Frequency Chaos Game Representation (2010)

6 Comments

Filed under Fractals, Genomics

Bioinformatics In Bengal

Dept. Biochemistry University of Dhaka

Visiting Bengal for the holidays I didn’t expect a thriving bioinformatics community. Yet, that’s exactly what I found when Dr. Haseena Khan invited me to visit her lab at The University of Dhaka. The Jute Genome Project was a consortium of academia, industry, and government which had sequenced & analyzed the Jute plant.

What Dr. Khan and her researchers lacked in cutting-edge equipment, they made up in passion, ingenuity & thorough knowledge of the most miniscule advancements in the field. After spending the day with them Dr. Khan insisted I meet with the industrial wing of the project.

Tucked away amidst one of the most clustered places on the planet, there are a few small buildings covered in plants, within them incredible things are happening.

Lush green home of scientists, developers & supercomputers at DataSoft

DataSoft Systems Ltd. created a sub-division, Swapnojaatra (dream journey) which would “put scientists, developers, and supercomputers in one room and throw away the key” as Palash the Director of Technology for DataSoft would tell me. Although the Jute Genome Project is now complete, the developers of Swapnojaatra are hooked on informatics. From the minute we met they were excited to show what they had done (within lines of existing NDAs) and ask what was new in the field from San Francisco. Indeed, the team here had discovered genomic re-assortment of the influenza virus, performed molecular docking studies of pneumonia and created many of their own informatics tools.

For a well-educated, computer savvy, developing region bioinformatics is a near perfect industry. With low overhead costs, compared to traditional wet-lab sciences and endless data being generated in more economically developed countries, it’s only a matter of time. Bengal and bioinformatics may have been made for each other.

 

Citations:

A Putative Leucine-Rich Repeat Receptor-Like Kinase of Jute Involved in Stress Response (2010) by MS Islam, SB Nayeem, M Shoyaib, H Khan DOI: 10.1007/s11105-009-0166-4

Molecular-docking study of capsular regulatory protein in Streptococcus pneumoniae portends the novel approach to its treatment (2011) by S Thapa, A Zubaer DOI:10.2147/OAB.S26236

Palindromes drive the re-assortment in Influenza A (2011) by A Zubaer, S Thapa ISSN 0973-2063


Leave a comment

Filed under Genomics, Microbiology